pet21 dead d loop (Addgene inc)
Addgene inc is a verified supplier 
91
Structured Review
Addgene inc
pet21 dead d loop
Pet21 Dead D Loop, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet21+dead+d+loop/pET21-E%2E+coli+Initiation+Factor+2+(IF2)+(Plasmid+%2331339)/10__1021_slash_ja505584f-23-22-5
Average 91 stars, based on 2 article reviews
Pet21 Dead D Loop, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet21+dead+d+loop/pET21-E%2E+coli+Initiation+Factor+2+(IF2)+(Plasmid+%2331339)/10__1021_slash_ja505584f-23-22-5
Average 91 stars, based on 2 article reviews
pet21 dead d loop - by Bioz Stars,
2026-10
91/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: SpyAvidin Hubs Enable Precise and Ultrastable Orthogonal Nanoassembly Article Snippet: For the addition of a C-terminal hexaglutamate tag to core traptavidin to give pET21-Tre (GenBank KJ906519, Addgene ID 59549), 5′-ATACATATGGCTGAAGCTGGTATCACCGGCACCTGG and 5′-CGCAAGCTTTTATTACTCTTCCTCTTCCTCTTCGGAAGCAGCGGACGGTTTAACTTTGG were used for PCR, digested with NdeI and HindIII, and subcloned into pET21. pET21-DTag (GenBank KJ906520, Addgene ID 59548) was generated by insertion of SpyTag (lacking the terminal Lys)15 at the C-terminus via a Gly/Ser spacer into pET21-Dead: sitedirected ligase-independent mutagenesis (SLIM)19 was performed with 5′-GTGATGGTGGATGCCTACAAACCTACGTAATAAAAGCTTGCGGCCGCACTCG, 5′-TAATAAAAGCTTGCGGCCGCACTCG, 5′-GATGTGGGCGCCGCCTGATCCTGATCCGGAAGCAGCGGACGGTTTAACTTTG, and 5′-GGAAGCAGCGGACGGTTTAACTTTG. .. To make Article Title: SpyAvidin Hubs Enable Precise and Ultrastable Orthogonal Nanoassembly Article Snippet: For the addition of a C-terminal hexaglutamate tag to core traptavidin to give pET21-Tre (GenBank KJ906519, Addgene ID 59549), 5′-ATACATATGGCTGAAGCTGGTATCACCGGCACCTGG and 5′-CGCAAGCTTTTATTACTCTTCCTCTTCCTCTTCGGAAGCAGCGGACGGTTTAACTTTGG were used for PCR, digested with NdeI and Hin dIII, and subcloned into pET21. pET21-DTag (GenBank KJ906520, Addgene ID 59548) was generated by insertion of SpyTag (lacking the terminal Lys) at the C-terminus via a Gly/Ser spacer into pET21-Dead: site-directed ligase-independent mutagenesis (SLIM) was performed with 5′-GTGATGGTGGATGCCTACAAACCTACGTAATAAAAGCTTGCGGCCGCACTCG, 5′-TAATAAAAGCTTGCGGCCGCACTCG, 5′-GATGTGGGCGCCGCCTGATCCTGATCCGGAAGCAGCGGACGGTTTAACTTTG, and 5′-GGAAGCAGCGGACGGTTTAACTTTG. .. To make |